>Intergenic-YOR122C-YOR120W scer_Chr_15 complement(552053..552297) 245bp
TTTATGCAGGTAAAGTTTTCTTGCCTTATACACCACCTATTCTGGCATCTGCGGGATTTC
GCTTCCTATTTTACAAATATTTTATTGATTGACGCTAATTATCACTGTAAAAGGCGCACT
TTTTATATGTAGTCACATCCGGTATTTAACATATTTACGAAACAGTCTTAAGAATATCGA
CATTTGATATACTTATGTTTAATTTATCTACATATTACAATCATACGAGAAACACGCAAA
AACAA

The gene YOR121C complement(551798..552103) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; open reading frame overlaps the verified gene GCY1/YOR120W