>Intergenic-YLR203C-YLR201C scer_Chr_12 complement(550294..550649) 356bp
TTATCGGGAGGCCATGCCCAACTTTCATCTTATAAATATATGCGTTTTCTACCGTTATTA
TAATTTTTTTCTTATGTATGATATCTCAATATCTGTAAATACAAAAATACTAACCCCACC
CCCTTCGTAATGGTTGACCTAATAGTCCATTAACTAATCCATTCACCTATACAGTAGTAT
ACTGACTACAGTTGCCATGACATATCCTTTCCTTTTCGGACTATATTAGGCGGAAGAAAA
ATAGCAATAACAATAGTAAGAAACAATAATACGGGGTTTTTTTTTTTTTGGGCCTACATA
AGGTACTTCACCCCAATTTGGAAAGAGATAACAGAGTCTTTACCACATTATAAATC

The gene YLR202C complement(550194..550458,550575..550636) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps the verified ORF YLR201C; ORF contains a putative intron