>Intergenic-YLR197W-YLR199C scer_Chr_12 (547612..547852) 241bp
AAGGAACAATGAATCGAAATAAAGTATATCCCATCTTTTTGTGTACTTTTCTTCCCTTTA
AAGTTTTTCATATATATATATATTATCTTTTATTCCCTTCTAATATTCTTCTTTAGGATT
TGGAAGCTGTATATTGTATATTTAGAAATATTATTAAATAAAAAAGTCATATGTTATTTT
GAGCTTAAGTACCCTCTTATGCCTCTTTCACTCGCCATTACTGACATTCTGTGATCGCCA
T

The gene YLR198C complement(547286..547645) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; overlaps the verified gene SIK1/YLR197W