>Intergenic-YGR136W-YGR138C scer_Chr_7 (763154..763761) 608bp
TATTCTGTCACGAAATATTTGTTTCAGTGATTTAAACTTACCCAATGATTTTCGTAGCTT
GAAAGAGAGAAAAACTCATACAGAATACGGATATGTGATGGTTGCTTAACGTAAAGAGCT
CCAGCAGGATTTTTGAGTTGCATAATGTCAATTAGCGTGTTGATTATCCCGCGCTTGAAA
TTATTATGTAGTACACTATAGATGTATGTACACACATATACATGGAATAAAAAGTTAAAT
GTGATACTGAGAACATTATTTGAAAACAAGAGACATTGGCCACGAGGAGTGTAGCGGCAA
TTACAATAATGTTAAAATTTAAAGGTGCAACTGTGTCGTCTTCGAATAAGCAGGCTTTAT
GTGAGAAATAACGGTGTATGACTTCAGGAAGAGTAGCAAGAGCGATCTTGATATTCAGAA
GCTGCAAAACAATAATACTTTGATATTTCGTTAAAGAGTATGTAGAAATGTCCGACGTTT
TTTTGAGAAGTTCCTAATATAAAATATTAAAAATTAATTTTTCAGAATATATGTGGAAAT
TTGTTATTTTTGTATCGTATATATGAATGACTAGAACATCATTATTTTTACCGGAAACTT
GCACCAGC

The gene YGR137W (762888..763262) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a functional protein, based on available experimental and comparative sequence data