>Intergenic-YDR115W-YDR113C scer_Chr_4 complement(681618..682174) 557bp
TCCGTCCTGCGATTACTACTGTTCTATTCCAACGTTTCTCAGTGAGTTTCTCCTGTAGTT
ATTTCACTTGTTGTACCTCACAGCTTCTACGGGAAAATTGGCTTTTCAAATTCCTTACAG
CTTTCGATCACGTGATCCGAGCTTCAAATGACCTTTCGACGATGCGTTTCATGATTATGT
ATATATATGTATATATATATATCTATACAGTCTTAAGGAAGCGCTTAAGTTGTTACATGT
TAATACTTTAGGGTTGGATTTATTTTACGGATAACATAGGATTTGCGAGAAATATCTGCT
TCACTATCACTTTCCGTGCGACGTGTGTATTTGTTAGCGTAGGTTGCTTATCGTTTTCAC
ACAAAGATCTCAAACGCGTCAAAAAACTCGTGTAAGAGGTCAAAAAGAAAAACAAACAAA
ATAAACAAACAAAATAAATGCAGCTTTAAATCAATATTCGGCGAAGGCAAGTAACGGTTG
CTAGCGGTTTTTCCCATTCACATACTATTACACTTCTGCGGTACCAAGCTAGATTAAGTG
CTAGATAATAAACCTTT

The gene YDR114C complement(681924..682226) is annotated in this region but switched OFF
Putative protein of unknown function; deletion mutant exhibits poor growth at elevated pH and calcium