>Intergenic-YDR111C-YDR113C scer_Chr_4 (679765..680495) 731bp
GTGTTCTTACTTCTTCTGTGTTTACCACTTACAAAAACAACACTACTGTGGCGCTCCTTC
CCTTTATTCTTATCTTTTATGCCTCTAGAGATATGAGGAAATATTGGGGTATTTACTGAA
TGAGAAAAGGATGATGTCAGTCAAGAAAGGATCAAAAAGAAAAGTGAACAGAATATAGTT
CCCACACGAAGTAGTAAATTTAGCTATCCTAAAAGTGTATTGGTAATTTGAAGAGATATG
TAGATGTACATATGGGACCATAAGAGTAGGAAAAATAAAATAAAATCGCCAAACAAGTAG
GAGAAGCCTCAAGATACAAGCCGTTTCCATGGAGAAAATATTGCGAATGAGGCCAAACTT
GAACTTTTTTTTTTTCTGCTAAAAAATTCAGAAAAAAAATGAAATTATTTTCTTAGGTAT
AATGAAGTAATTATGACGAAGTACTTTGAGAACCCATAAAGAGAAGCAATTGAAGACGTG
TGGAGGACATCAGCCCGCAGCACATTAGTAGAAACAATAGTATCGTGATGTGATCCCTCT
TGGACCCTTTGCCAATCAAGGGTGAAGCGAAGCCATTTAAAACGTACGAACAATGGCGGT
AGTTGAGGTATGGGTGAGGCCGCAGATTAAATCCCGGCGGCAGGAGCAACCGCTTTTAAC
CAGAATTGTATGTTATAAAGTATCTGTATATACGTGTATATATGTTGTGTGTATGTGAAT
GAGCAGTGGAT

The gene YDR112W (679544..679852) is annotated in this region but switched OFF
Dubious open reading frame, unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps YDR111C; null mutant displays increased levels of spontaneous Rad52p foci