>Intergenic-YCL059C-YCL058W-A scer_Chr_3 (23380..23583) 204bp
CGTTTGCCAATTTGGATATTTGTGTGACCCTTTTGTTTGCTGTCTACTTTACAATAGTTA
ACCTCATCATCTCTTTTTTTTGAAAATTTTCATATCTCATCGCTAAAAGAATTAGAAATA
TAAGGAAAAAAAAATTTTCGTTTTCAGATGTGCAAGCCTGCTATAATAAGGTACAATAAC
TCAAGGGCATTTAGCAAGGAAAAA

The gene YCL058C complement(23523..23981) is annotated in this region but switched OFF
Protein involved in regulation of the mating pathway; binds with Matalpha2p to promoters of haploid-specific genes; required for survival upon exposure to K1 killer toxin; involved in ion homeostasis