>Intergenic-YCL025C-YCL024W scer_Chr_3 (77920..79161) 1242bp
TGTGCGAAGCTATCTTTGTCTATATTAGCGTGCTTCTTCTATAAAGATTACATAATAAAC
TTGTTCTACATTGTTGTGGGCAGACCATCAAAGACAAAGCACTTATATATGTATGTAAAA
CAAATGAGTATTACGAGGAAAATAACAAAAAGAAACTAATCACGAAGGATATGAGTCTTG
TTAGCGGACGAGGGGAAGATAGCGCAAGACACACGTATAGCCGACCTATCCTATGCATCT
TAGCCGTCTTATCAGGATTGATTTGCGGTTCAGTGAAAGAGATAACCACTGCCAAGCTGG
AAGAAATGGCTAGAAGGCACTAAAAAAAGAGCCTCGCAGCGCAACTTAAGAACTGTGGAC
TACTAAGGAGCAGCAATCCGCTGGACGTGGGGGAGTTGAAAGTTGGCCGGATACTGCAAC
CTGCTTATCTATGACTCGATGAGACCGTTATTTAGTGCGATGGTGCCACTGGGAGTGCCA
TCAACGGCAAAGTTGCAGCTTTTTGCAGCAGATCAGTGCCGCTTAGACGGCACCCTCAAG
CGGCACTGAAGAACGGCGCGCTTTTTTTTTTCTTCTATTATGCCGGTCAAGGAAAAAAAG
AAACCAAAAAAAAATGCCGTGGGAGGCACGGATGCAAGATTTCTCCAAAGTCCCTTTTTA
GCCGCCGAGGAAATGAGGAAATAAGGGGTTAGCCGCCGAGTGAAGCCGCCGAGGTATAAA
AGGGAGAATGCACACCTTCGTAAGAAGATTCTATTTGAAAGAGTGCTAGGTAAAGTCATC
AAAAGGCTTATTGATATAATAATTGCTTTGCAAAATGGAAAACAAATGACTTTGAAAATG
GGAGAAAACAAAAATTATATAGGTAATGTTGAGTTCTTGATTTTTTTTTTGTTTCTGTCC
TTGCCACAGCTCTTTTCATGGAACATTGGGCTCTAGGATAATTTTTTTATGTTTTCTGTT
ATGTTTGCCATGGTAGGTTGAGGTAAAGGCGCTCTTTCAGCAATGACGATTTATGCTAAT
ATGTTTTCCTTAAAAGGAAAACATCTCGTTCTTTTTTTCGCGTGCTGTGCAAGAAAACGC
GTAACGCAGTCTTAGTAAAAGGGCTCTCTTGAAAACTACATGAAAACTAAAAAAGAAGAT
GTAAATTTGGATACAACAGCGTAGAATAGCATAATAGAGTGTGCAATAAACGTGTATAGG
CTTGATAATAGTGCTGACGTAAATTACCAGAACTACTGCAGT

The gene YCL023C complement(78949..79296) is annotated in this region but switched OFF
Dubious open reading frame unlikely to encode a protein, based on available experimental and comparative sequence data; partially overlaps verified ORF KCC4