>Intergenic-Kwal_YGOB_YDR119W-A-Kwal_56.23754 kwal_s_56 (689760..690850) 1091bp
AATGTTAAAATGTGGGTTATTGTAAGTACTGTAGAATAGAACTGTAGATATAAGACACGA
CTAAGATATTATGGAAACCAAACCAAACTACGCTCTTATATACAGAAAACAGGAGAAACA
GCTAATACAAACATTTCTAACATCCCTACAATAGTGTCAGTCATCGATGGTGTGATTATT
TCGCTACAAACCCACTCCGGGGCTTCCTACAAGTTTTTACCCGATCAGTCCACTTCCGGG
GTACCAGTTCCTTATTTTTGTGGGGAGATGAGGCCATGAGACGGCAGCAGCAGCACCAGA
GTGGTGTTATTATACCCGAAAAACGAAGCTAGATCACACCATTATGATAATTATATACGG
AAAATTGAGTGTAGACAAAGCAACGGTGTGAGTGTTTGGCAGAAACAAGCGTAGGGATGG
GTACGGGGAGACTTGTAAACGGCTGATAAGAAGCTAGCAGCAGATGGGACTGGTGCGATA
TATCCGGGTATGGCTGGTAGTTGAGTTGCAAGATATTGTGGAGTTGGTAGTTATGTACGA
TGTGTTGGTTTTATGGTCGCGTTGGACGAGGTGAGAGGACGAATTGGAAGGAAGTCTCGA
TGAGACAGACGTTCCTGCTTTCGTGGAGAAGTGTTTTAGAAGGTTTAAGATAGAGGGTAT
GGATGGCATTTGTTGTGGGGAAACTGCTTTCGCTATGGGCGTAGGTAGGTTTTGGTTGGT
GGAATGAGAGTCGAGGAGCCTCTTTGATTTTCCGTTATTTGTGATCTGTCACGTGACATG
AACCGGGTACTGTTAAGGATAGATGGACGGGGTACGAGTCCCCCCACACCAGGTTGAGCG
AGTTTGAGCTAGCTTGGGCAGCTTTATCATCGGTTTTCTACCCTTGTTAGGTTCTCTCGT
CACTCGAAAATGTAGAATTTGCTTGCTAAGCGTCAAATTTGTAGTCGGTCATGTGGTAGC
ATGAATCATGCACTGTACTTGAGCAACTGACGGCTCATCGACTGGGTTGATCCACACAGT
CTTGGACTTGCTAATTAAATTCTGGCGACTCTGTGCATTCGGTTGATGTTATATCTTCGG
TAATCCGACCA

The gene Kwal_56.23753 complement(690213..690428) is annotated in this region but switched OFF
[contig 173] FULL