>Intergenic-Kwal_56.24650-Kwal_56.24648 kwal_s_56 complement(1088480..1089567) 1088bp
GTGATGCCTTGGATTTGAAAGATCATTCCATTGTTTAAACTAGTTTCGTGAGTGTTAGTT
TCTAAGTAGATACTCGAAAATCAATTGTTGGGTTCATACTAGCATTTGAAATCTTATAAG
CAGTATAGATTAGTTTTGATTCCTCAATAATGGCTAATCAATGTCAACTCTATGTTAAAT
TGAAGAGGGATGCGAATATACCTTGTTCGTCCACTGAGACATGAGTATCTGGAGTTCAGA
ATCTGAAGAACCATTTATTCAAATATAATGGAAATATACATTGGTCTGAGAGAGCTCGAA
ACCTTTGATCTTGTGCCGATTTTGCCTGATATTTCCTACTAAATCTATTTAATTGCGATG
CCATTTCTTACTAATATAAGGGTCTTTACGGTCTAATGTATGATATTTTAGGCCCATCAA
TTGAATGTACTGACGGATTTGTGAAACCGTCCTAGCACTGCTAACGATTGCATTGACAGG
GGCTTTGAACATATATTGAATTTTTAATTGTAGACGCCAGGTTTTGGCATCAAGCCGCAT
TTCTGGGCGGAGTGTCATATCTATGTCGACTACTACTGCCGTACATGGAGAATTTATTTC
AAGAGCCTCTATAATTTGTATGCAATAATTGCGTAATGCTTCTTTATACTAGCTTGTCCA
TCCCTTGGCAATCAATTAGGAACATCTTCAATAAATTAAGAATAATTTGAAGCGCTGGCA
ATGAGCGGTGTCTGTGACCGTCTAGCCCAAAATCTAAGACCATTATTTGTTTCTATAGTG
CATTAGCTGGACCTGGATATTGACAATATCAATGGTTCAATTGTACCGGAGACTATCTGT
TTACAAAAATTGATTAGACATTTATTGACGGCGCTTACATGCGCTCAGGATCAAGTCTTA
AATTAAGCTAATCCACTGCCCATAATAGCTGAGGATGTTTAAATTAGTCTTCCAGAGCCT
TTGGCCCTTCCTTTTGTGAGCTATGTCTAAAATACCAGGTACTTCCAAAATTTCTTCATT
TTTATAGAGTAAAGAAGTTGATGATGATCAATTAACCTAACAGAAGGTCAAAATAGCATA
CACCAAAG

The gene Kwal_56.24649 (1089010..1089219) is annotated in this region but switched OFF
[contig 161] FULL