>Intergenic-Kwal_56.24648-Kwal_56.24650 kwal_s_56 (1088480..1089567) 1088bp
CTTTGGTGTATGCTATTTTGACCTTCTGTTAGGTTAATTGATCATCATCAACTTCTTTAC
TCTATAAAAATGAAGAAATTTTGGAAGTACCTGGTATTTTAGACATAGCTCACAAAAGGA
AGGGCCAAAGGCTCTGGAAGACTAATTTAAACATCCTCAGCTATTATGGGCAGTGGATTA
GCTTAATTTAAGACTTGATCCTGAGCGCATGTAAGCGCCGTCAATAAATGTCTAATCAAT
TTTTGTAAACAGATAGTCTCCGGTACAATTGAACCATTGATATTGTCAATATCCAGGTCC
AGCTAATGCACTATAGAAACAAATAATGGTCTTAGATTTTGGGCTAGACGGTCACAGACA
CCGCTCATTGCCAGCGCTTCAAATTATTCTTAATTTATTGAAGATGTTCCTAATTGATTG
CCAAGGGATGGACAAGCTAGTATAAAGAAGCATTACGCAATTATTGCATACAAATTATAG
AGGCTCTTGAAATAAATTCTCCATGTACGGCAGTAGTAGTCGACATAGATATGACACTCC
GCCCAGAAATGCGGCTTGATGCCAAAACCTGGCGTCTACAATTAAAAATTCAATATATGT
TCAAAGCCCCTGTCAATGCAATCGTTAGCAGTGCTAGGACGGTTTCACAAATCCGTCAGT
ACATTCAATTGATGGGCCTAAAATATCATACATTAGACCGTAAAGACCCTTATATTAGTA
AGAAATGGCATCGCAATTAAATAGATTTAGTAGGAAATATCAGGCAAAATCGGCACAAGA
TCAAAGGTTTCGAGCTCTCTCAGACCAATGTATATTTCCATTATATTTGAATAAATGGTT
CTTCAGATTCTGAACTCCAGATACTCATGTCTCAGTGGACGAACAAGGTATATTCGCATC
CCTCTTCAATTTAACATAGAGTTGACATTGATTAGCCATTATTGAGGAATCAAAACTAAT
CTATACTGCTTATAAGATTTCAAATGCTAGTATGAACCCAACAATTGATTTTCGAGTATC
TACTTAGAAACTAACACTCACGAAACTAGTTTAAACAATGGAATGATCTTTCAAATCCAA
GGCATCAC

The gene Kwal_56.24649 (1089010..1089219) is annotated in this region but switched OFF
[contig 161] FULL