>Intergenic-Kwal_56.24610-Kwal_YGOB_Anc_7.341 kwal_s_56 complement(1073685..1073854) 170bp
GTAATAACACCAGTTACGGCGACGCCTTTCGACTTTTAAACCCATTTCTACCTGTACTAT
ATAAAAGTTACTCTTTGTGCTAAATGGTTAATGCTAGTACCTCACAAACTCAGTAGCAAC
TGTCCGTGCTCTGCTGTTCACCGAGACTTCAATTAGGTGAAGAGTGGTCC

The gene Kwal_56.24609 (1073810..1074127) is annotated in this region but switched OFF
[contig 161] FULL