>Intergenic-Kwal_56.22462-Kwal_56.22459 kwal_s_56 complement(139715..139778) 64bp
GAGTTAGCCGCCGATATGTAATTATAAGCCATATTTTCCCAGGTTAGACAAAACATGATG
AAAA

The gene Kwal_56.22461 (139723..140163) is annotated in this region but switched OFF
[contig 185] FULL