>Intergenic-Kwal_56.22459-Kwal_56.22462 kwal_s_56 (139715..139778) 64bp
TTTTCATCATGTTTTGTCTAACCTGGGAAAATATGGCTTATAATTACATATCGGCGGCTA
ACTC

The gene Kwal_56.22461 (139723..140163) is annotated in this region but switched OFF
[contig 185] FULL