>Intergenic-Kwal_56.22399-Kwal_56.22403 kwal_s_56 (111846..112079) 234bp
TCGGGTTGTGGATTTCCTTCTTTCAAAGGACAAAAGGTATATATCTGCTCGGTTTCTTTT
GCATCGCGGTTAAAATTATGAACTGGATATCAACTTCTCGTATATAACTATAATCTAAGG
GTCGACGCGTATCTGTTGCTCGGCAACATCTCATCTTTGAGTAAACAAAAGCTGAAGAGC
AGTATTGATTTGGCAAAACGGCACCATTGAAGTAGTTTGATCTGGCTGGAAACC

The gene Kwal_56.22402 complement(111953..112234) is annotated in this region but switched OFF
[contig 185] FULL