>Intergenic-Kwal_56.22396-Kwal_56.22387 kwal_s_56 complement(108959..110069) 1111bp
TTGGTGTGCTTGATGCTCTAAATTTTAAGCATTTCACTAACTTCGATGTGAAGTTACCTT
GCCTCGATGCCCCCCAAATCACTACGTCTTTTGTATATTTTGACATGTCCAGCCATGTTT
TTTTGTTTAGCCTCCGTGAACAAAACTCGCATAATATTGCGTTAGTCGGCAGAGCCGCAT
CTGTTGTATTGGCTACGAGAATTTTTCTGGTTTCCAACGTGACTGGCAGTTACACAATGT
AGAAGGCTACTAAAGTTGCAGGAGGTTGCAGAGACAGATGAGGTTTGACATGTTGAGAGT
GACGGAGAATTAGGAGTGAGGGGGTTTTTTTCAAGGGGGGAGAGGGTTGTGACGCAGTGG
GAGTAGTTGTTGCTTTGAGTGTGGTATTTGAATTATGCCAGCGATGATTGGTGAGTTTGA
GTGTGAGTGTGAGTGAGTGAGTATGTGTTTTATTGCAGCGAACAGTGTAATGGAGCGTTG
GAGGCCCAAGGCCCCGCGATTAGTGCCCACCGCTTAGTGCGACACGCAGAGCCTTTAAAT
ACGTCAGATACTCTTCTATACTTCAAGGTAAAAAAAAACGGCACACCGGAGACGTAGCAG
GCGCGGCGATATTTTAGAAAATGACACAAGAACAGTATGCGTAGCTTTTCTAAGGGCCCA
GTGACATTGGAGACGCGACTTGAAACACTTGTTCCGGCAGATGGGTCTCACTGACGTGGT
GGGTGTGTCAGAATAGCGGAATGTACCGAAATTCCCGACAGAGACCCCGCGGATCTACAT
TCTACGCATGAGTCCAATTTCAAACCAAGTAGTTGGCAGGAATAGGAACATATCCATGGT
GTATTTCGAAAGGAAAACCCAAATTCACAAACAAACATATAAAATCTATATATCAATCAA
TGGCAATTGTTCTAAAACTAAACGCGAAGAAAATGCATAGCGATGCGCGCTGCTCTGTAC
AAAAATATAATATTTTTTTTTTTTAGGTCTTTTTTTCCAGCAAACTCGGCAATTCTATTT
CCCTCTTTTCGGGAGTTCATTGGGTTATGAGATGCTCGCGCTGGCGTGGTGGGATGGGGA
AGCCCGACAACTACCGTGCCTATTCTACAAT

The gene Kwal_56.22395 complement(109828..110079) is annotated in this region but switched OFF
[contig 185] FULL

The gene Kwal_56.22392 complement(108773..109018) is annotated in this region but switched OFF
[contig 185] FULL