>Intergenic-Kwal_56.22387-Kwal_56.22396 kwal_s_56 (108959..110069) 1111bp
ATTGTAGAATAGGCACGGTAGTTGTCGGGCTTCCCCATCCCACCACGCCAGCGCGAGCAT
CTCATAACCCAATGAACTCCCGAAAAGAGGGAAATAGAATTGCCGAGTTTGCTGGAAAAA
AAGACCTAAAAAAAAAAAATATTATATTTTTGTACAGAGCAGCGCGCATCGCTATGCATT
TTCTTCGCGTTTAGTTTTAGAACAATTGCCATTGATTGATATATAGATTTTATATGTTTG
TTTGTGAATTTGGGTTTTCCTTTCGAAATACACCATGGATATGTTCCTATTCCTGCCAAC
TACTTGGTTTGAAATTGGACTCATGCGTAGAATGTAGATCCGCGGGGTCTCTGTCGGGAA
TTTCGGTACATTCCGCTATTCTGACACACCCACCACGTCAGTGAGACCCATCTGCCGGAA
CAAGTGTTTCAAGTCGCGTCTCCAATGTCACTGGGCCCTTAGAAAAGCTACGCATACTGT
TCTTGTGTCATTTTCTAAAATATCGCCGCGCCTGCTACGTCTCCGGTGTGCCGTTTTTTT
TTACCTTGAAGTATAGAAGAGTATCTGACGTATTTAAAGGCTCTGCGTGTCGCACTAAGC
GGTGGGCACTAATCGCGGGGCCTTGGGCCTCCAACGCTCCATTACACTGTTCGCTGCAAT
AAAACACATACTCACTCACTCACACTCACACTCAAACTCACCAATCATCGCTGGCATAAT
TCAAATACCACACTCAAAGCAACAACTACTCCCACTGCGTCACAACCCTCTCCCCCCTTG
AAAAAAACCCCCTCACTCCTAATTCTCCGTCACTCTCAACATGTCAAACCTCATCTGTCT
CTGCAACCTCCTGCAACTTTAGTAGCCTTCTACATTGTGTAACTGCCAGTCACGTTGGAA
ACCAGAAAAATTCTCGTAGCCAATACAACAGATGCGGCTCTGCCGACTAACGCAATATTA
TGCGAGTTTTGTTCACGGAGGCTAAACAAAAAAACATGGCTGGACATGTCAAAATATACA
AAAGACGTAGTGATTTGGGGGGCATCGAGGCAAGGTAACTTCACATCGAAGTTAGTGAAA
TGCTTAAAATTTAGAGCATCAAGCACACCAA

The gene Kwal_56.22395 complement(109828..110079) is annotated in this region but switched OFF
[contig 185] FULL

The gene Kwal_56.22392 complement(108773..109018) is annotated in this region but switched OFF
[contig 185] FULL