>Intergenic-Kwal_56.22345-Kwal_56.22350 kwal_s_56 (59714..60827) 1114bp
GCTTTCTACTCAAAGCATTTCTGTAGCTGAACATTTTCAGTATTTAACAAAATGTTGATT
CTGTCTTGCATGAAATCTCCATTCGTCAAAGCTATATGCTTATATAATCATATTTATAAT
AGTTAAAAGCGTCTGTTTTCAGATATTGAAATAGATTTGACTCAGGAGCTGACCCTCTTT
TTCTATAAAGACTGGTTCTAGCTTGAGGCTTCGATGCTCTTACTCAAATAACGTCTGCTA
CTAATTTCAGCAGTTGTGGCCACCTTTTCTCAAGCTTCTCCAGACTTATTAACTTTACAA
GCACCATTTCTCTGTGCAAGAACCTACATTTCCTCTTCTTAGGTTTACGTTGGAGCATAT
AACGGTTCCACAAGACATAATCATAAAATTTAATCCTGAATAGTAGGATTTTACCTTTAG
AACAAATTCGTGAACGGATCACGGAGACTGTAGTTGCGGCGTAAATTCCAAGAAAACAAG
CCTTTGATAAATCACTTATTTGTAGGTAGAGTTTCCTAGTAATTATACTCCCCATCAATA
CTCTGATAGTTGAGGTGATACACATAGCCGACACATATTGTTTAGACGTGAATTCTTGTT
CCCAGCTCTCCACGGTTTTATAAACCGTAATCATGATGCCAGCATCAACATAAAAGGTTC
AATTACTTCACGTCAAGAGTTTTGACGATTGGAATTCATGCGGATCTGGTCTCGTATTCC
CCAACAACAAAGACAGGCCTTCAAAAAACGTCTATTAGTATTAAATAATGAGCAACCGGC
ATTATGAGGAGAAGCGCTACTCTAATTTTCCTTTCCATGATGGGTTCGCTACCACCTTCT
GTGTCCTGAAATACACGGAGTTTATTTCTTGGCCTAGGGCATAGCTTCTAGTTTCTTTAT
GATGCATAAATCCCGTGTTGGGTATTTGAACAATTGCTTAGGTTATAGGCGAATTACACC
AAAATGCTCAAGTCATAAGCGAATTGCACCAAACCTCTTGTGACAACCCGTGGTTTTTCT
TAGGGCCCATCAAAAGTGTAGTTTCGCAGTGTTTGCTGTTGTCAGTTCGGAAGAATGCTC
CTCTTCTATTAAACTAAATGTTATATTACGTAGC

The gene Kwal_56.22349 complement(59937..60347) is annotated in this region but switched OFF
[contig 186] FULL