>Intergenic-Kwal_56.22341-Kwal_56.22334 kwal_s_56 complement(56505..56938) 434bp
ATTAGTTCGACGATGCAATAGAAAAGCTTACCACCTTGAAGAGAAACTAAAGTTTTTGTG
CTGTTAAGAGCACTCAACTTATAGGGTTCTCATCCCGTTCTTGTTCGTTTAGAAGTTAGT
TCGTCTTTGTTATGATATGGTAGTTTTCGATATCGTTTTGGCAGGGATTGCCAAACTCGT
TTAAAAATCGTTTAGTTCCCCCCACAATCATCAAATATCTTCGTAAGCGACCCTTGCTGG
TGGCATACTGAGCTATACGTGGCTTCAAACTCAAACATTCCTTGACGCTAAGAGTACCGC
CCAAGCAGCAGAGATATTGGGTGATACATAGTGATCATGACGTAAGCATGACTTGGCTAC
AACATTTACATCACAGTGGGCTATCGATCGAACAGCGTATGCTCGTGTGTGCTGCGCCTC
ATATCGCAGTACGC

The gene Kwal_56.22338 complement(56340..56591) is annotated in this region but switched OFF
[contig 186] FULL