>Intergenic-Kwal_56.22334-Kwal_56.22341 kwal_s_56 (56505..56938) 434bp
GCGTACTGCGATATGAGGCGCAGCACACACGAGCATACGCTGTTCGATCGATAGCCCACT
GTGATGTAAATGTTGTAGCCAAGTCATGCTTACGTCATGATCACTATGTATCACCCAATA
TCTCTGCTGCTTGGGCGGTACTCTTAGCGTCAAGGAATGTTTGAGTTTGAAGCCACGTAT
AGCTCAGTATGCCACCAGCAAGGGTCGCTTACGAAGATATTTGATGATTGTGGGGGGAAC
TAAACGATTTTTAAACGAGTTTGGCAATCCCTGCCAAAACGATATCGAAAACTACCATAT
CATAACAAAGACGAACTAACTTCTAAACGAACAAGAACGGGATGAGAACCCTATAAGTTG
AGTGCTCTTAACAGCACAAAAACTTTAGTTTCTCTTCAAGGTGGTAAGCTTTTCTATTGC
ATCGTCGAACTAAT

The gene Kwal_56.22338 complement(56340..56591) is annotated in this region but switched OFF
[contig 186] FULL