>Intergenic-Kwal_56.22329-Kwal_56.22333 kwal_s_56 (52779..53023) 245bp
TTGGTACTATCCTACTACCGAAAAAATAATTCGAGACGACAAAACAGCGGCAACAGCGAG
TTGAGAGCATGCCAAATATCCTCTCTCCAGGCATTGGTGACACTCCTCCCCCCGAGCTCT
TGATAAACCATCTATTGACGTGAATATAAACTTTAAACTGTTTCCTTAAAACTTCTTTGT
ATACAAGCTGCGAGAGGCTCCGGTGCATCGATAATTATCCTCCCCATAAAGGAAGCATGC
AGCGC

The gene Kwal_56.22332 complement(52678..52986) is annotated in this region but switched OFF
[contig 186] FULL