>Intergenic-Kwal_55.21468-Kwal_55.trna25K kwal_s_55 complement(851524..851686) 163bp
GTTAGCTGGGATTACTAAATAGGCGCAATACAATACAGGCTTGGCTCGATAACCTACTCC
ACCCAATGTACATCTAGTAAAACTCAGATTCAAGAAAAAAGTCATATGTAGTTATTTGCT
CTATACAAATGACAAATCAGCTCGCTTTTCTCAAGAATTAAGA

The gene Kwal_55.21467 (851582..851983) is annotated in this region but switched OFF
[contig 130] FULL