>Intergenic-Kwal_55.21437-Kwal_55.21444 kwal_s_55 (838507..839766) 1260bp
TTTCTATAGCCAATACTCTTGATTATTATCCACTTGTCTCATCATCGGAAAGGATCATCA
GATGTGGGGATTGCGATGCGCGGTAAGTGAATGAACCTATAACGTGACTTGATGTACTCG
CCCCAAGTACTCATCATTTATATTGTAAGATAGCCTCGTTGAGTCACTGACATCAACCGT
AGAGCTCTTTTCAGCTGTCAAGAGGTTCAGTATGTATTAATTAAGCTCCTTTTCGAACCA
GACATTTAATGACACTATTTCAAATCCAGGCGTCGCGTTGCGTCGCTTGGTTTTACTTGT
CACAAGTAAGATCACGAAGGGATAATACAAGATTTTAACGATAAGAATGGTGAGTATATT
CGGTTGGTGGCTAACTTTATGTTCCTGGAGTTCTTAGGTTGTAGGTAGGTTTTCTTCCAA
GAAAGCTTTTTTTTCTTTGATACCTACAATTAGAAGTATTTAGCGATTCCACATCAAAGC
TTTGGATAACGTGCTCGATAGCGCGGATAATTACAAGCATCGAAAGTATTTCATCATCTG
TCCTCCACTGCCTAACTGAAAAGTCACATCATTTCTGATATTTAAACCCCCCTCTTCGTC
ATTGATACTATCCCATATTTTTCTGGTTCTGAACTTAGAACTAATGACGATCTTTTCATA
GCATTCGATATTTCGTGGATATTAAATCTGACATCTGTTAGTAAAGCCATTTCTGAACTT
CGAACGCGCCCTTTGTAAAACCGGAAACATCTTAAGGCCTGTTCTCATGGATTTAAGCGT
AATGCAATCATGTATCATCTTGTGATTGCATTATCAGTCCATTATAATACAATCCGATGC
ATCACTTGCCATCACAACCTACCTCAAGACAAGAATCATCTGATGTACCTAATGGTGAAT
AAAACCTTGGATGGTGTTGTTACGTTAATGCCAGAATTCCTCCTGCTCCATCCAATAAGT
ATTCTAGGTTTTGCCGACCACATGATATTGATGGCTGGCTAGAACTATTCCATAAGAAAA
CTAGTCCTACAATAAAAACGTATATATTTCAGCTTCGTAATGGTCACTTCGCGATCTGTG
TTAGTTCACTAGACCGTTTGATATATACTGTACTCTTCATTGTACTCATGATTTTTCAGG
AAAATTGTTTACAAATTTTTACAAGGCCTTCAAAAATCGCATCGCATCGCATCTCATCTC
ATCTCATCATTGCACAATACAAGCGCGCAAAACTGACAAAGGAAGAAGCCATCTTGCAAT

The gene Kwal_55.21443 (839634..839792) is annotated in this region but switched OFF
[contig 130] FULL