>Intergenic-Kwal_55.21240-Kwal_55.21238 kwal_s_55 complement(745505..745937) 433bp
AGTTCATTAACTTTCAAGCTCCTGTGCTGTTGGCTACATTCACCTTGTATATATAGGTTA
CCAAAAGAGTTAAGCTTTGATACTTTGATTATATTATGTATGTTTGGAAGAAAAGTTTCC
GGAATTAGTACACAGGTAGGGGAAAAGTGTGCGTAACTAAAAGATAAAAGAACGAAAGTT
GGGTGGGGGGTGGGGCGAAATTGCGTGTTTGGGTATGACGAATATGAGAAAAGGGAGTGT
GAGCAACTCAGAGGTGGCGTAGTGAAGCCAAGATAATAAAAAATGAAATTGAAAGTAAAG
GCTGTCCAGTCGGTGCGCCGTTTACCTCATATTTGTTGCCGTTTTTTTGTTGTTTTTTTT
TTGTTGCTGAGGAGCAGGGGAGGGATAATATTACATGGACGTGAAAGTAAAATGGTGACG
GGGTTCGACACTA

The gene Kwal_55.21239 complement(745317..745655) is annotated in this region but switched OFF
[contig 130] FULL