>Intergenic-Kwal_55.21238-Kwal_55.21240 kwal_s_55 (745505..745937) 433bp
TAGTGTCGAACCCCGTCACCATTTTACTTTCACGTCCATGTAATATTATCCCTCCCCTGC
TCCTCAGCAACAAAAAAAAAACAACAAAAAAACGGCAACAAATATGAGGTAAACGGCGCA
CCGACTGGACAGCCTTTACTTTCAATTTCATTTTTTATTATCTTGGCTTCACTACGCCAC
CTCTGAGTTGCTCACACTCCCTTTTCTCATATTCGTCATACCCAAACACGCAATTTCGCC
CCACCCCCCACCCAACTTTCGTTCTTTTATCTTTTAGTTACGCACACTTTTCCCCTACCT
GTGTACTAATTCCGGAAACTTTTCTTCCAAACATACATAATATAATCAAAGTATCAAAGC
TTAACTCTTTTGGTAACCTATATATACAAGGTGAATGTAGCCAACAGCACAGGAGCTTGA
AAGTTAATGAACT

The gene Kwal_55.21239 complement(745317..745655) is annotated in this region but switched OFF
[contig 130] FULL