>Intergenic-Kwal_55.21226-Kwal_55.21222 kwal_s_55 complement(737476..738729) 1254bp
TTAGCTGCTGACTACCTAACCCTCTTTACTGCAGAATGTAGTACGCACAAGTCGACTTGG
TTTATAGCTGCTCATCAGTTGGGCTACATCGCTAGTATCCCGCAATTCACTTAGAAAGCT
ATTGGTCATGTGACAAAGTTCAAGAAATTGAACCTGTAATTTGATCACTATTAACGCACC
CAGTATACTTGTCTCGAGTCCTTTTTAAAACGTGATCTTGAGTACATCATCACATTAGAC
GTATAATGTTATTATCCATGGTAGTTCCTGTTTGAAAAAATTTGCGCCGCCCGTGAGGCG
ATGAGATGGGCTAGCTAAGAACAACTTGAATTCGCAACCCTCTCACGTCTTGAACGCTTA
TGCCGTCCATTTCACAGCCATTCCGGCTCACAGCGCTTCCCAAGATTGCTTCGCTCAACA
ATTATGCCACACAGGGAAGTTACCTGCAAGTTGCAGACACTTTAACACCCGCTACAAACA
GAGTTAATGTGGGGATCTCTGGCTCAGCCATCTCTCAATACGTGATAAATCCCACGCCGA
AGCTGGTGTATAACCTGCCTATCTCGTCCACCAATGTTGTGACTGCTTGCGACGTGGCTG
AAGTGGCAGGCACTAACAACGAGGGAACCGCTGAAGCTCACGAAGTGCTCTGTTACGCTC
TTCAGGCAAACAAAACGTTCTCTATTTGCGCCGTTAAGAAGCCCATTCCTTCGGCTGCTA
CAGACTCTAGCTTTGGAGAGACGTACGCCACTCACAAAGTAGCCCTTGCTAACCAGGCCG
TGAACGTTAAGGTCTTTCCCGCCACGAAATCCATCGTAGCAGTTCTGTCGAGTGGTCTGA
TCCAGTTCTTTGACTACGATCTGAAACTACAGCATTCCATTGACTCCTCCTATGGGAATG
TTCAGTTCGTGCAGCACTTTGTCAGCGAAAGTAAGCAAGACTTCATGTTCCTCCTTAGCG
ACCTAGATGGCCGCAAAGTCTCTTTTAAGCTGTTGAAATCGGACAGNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNGGAAGATCTGCCTTTGAAAGGCTCCAAACTGGTG
TATCAATTTGGCAAGGTATACAGACTACATGGTACAAGTGTGGATATCTACACTTTGCCT
CACTTTCAGCATTCCCAAACGATCGCACTACCCTTTTTGGATCCAAAGGGAGTC

The gene Kwal_55.21225 complement(737726..738370) is annotated in this region but switched OFF
YGR128C (UTP8) - Protein required for cell viability [contig 130] PARTIAL