>Intergenic-Kwal_55.19721-Kwal_55.19729 kwal_s_55 (97627..98217) 591bp
TGTTTGCCTTAAGGTATACTTTAATTCAACTCGCTCTTGCTAATTTGCACTACAGTTATA
TACCTTGAGACCAAACGACATATTGTCCTATTCCTATCGCGAGTGCCCACGCAAGTCACC
GCTCAATTACTCCGCATTGATCAACTTGAAGCCCTCGCTTTGATAAATTGTATTGTCCTT
TCACCACTGCTCTCACTAAGCTCTTCGAAAACTTTTTTTCGTTATCTAAATCTATCAATA
TTTTTCTATCTAAGCGCCTCACATAAAAGATACGGTGTAATTTAATCACCAGTCATATAA
CAGGAGACCGACCGATTATCAGAACCAAGAAGAGAAGAAGACAAGCGCAAGTGTAGTAGG
TGAAGCGCAGGACTTCTTCCTTGGATGATAGTAGGAATAATTGAGAGGACAGTTATCGTA
GGGCTTTTTCAGAGCTTCTGTAGGGTATAGTTAAAAGATTAAATCTATCTCCATGCAGTT
TAACGTTAGATAATTTGTGGTGATAGATGCATTGTGATGTGAGAAGCTTTCAAACATGGT
GTTTGGGCGCCCAAGAGGGTATCTCGAGGCGGCAGGATTAAGGTCGGCATG

The gene Kwal_55.19728 complement(98112..98282) is annotated in this region but switched OFF
[contig 159] FULL