>Intergenic-Kwal_55.19663-Kwal_55.19675 kwal_s_55 (72570..74606) 2037bp
AGCTAATTGATTTGATTGATAAAGGCAACTTTAAACAAAACGATCCATGTAAGAATGTTT
GTCTGATGAGATAGGACTAGCCTGAATTATTCAAAGTAGAGACTCGCTGTGTTATATACA
ATTTGCTAGACGCCCTGCTTGTGTCAATTTGGCGCCAACGCTCCGATGCCTTTCCGGCTT
GCCCCGACTGAAATTCGGCCCAATGCTCGATTCACCGTTTGTTCTTAGCGTCAATGGAAC
AAAGACTCCGACAACGTCGGAAAGCGTCGCGTTCAATACGCGTCGCAATTAAGAGCTACG
AAATCCTTAACACAAGCAAAAATACGAGTTTATAATCTCTAAAAACTACGTTCAAGCATT
TGACATTGAGTAGATTGCCCTTGTGTCTTTCTTGACCTCTGCTTCAACTATTGAAATCAT
TCATTTCCCTTGATTTCACCACCGCCCATAGAACGATCTTCTTCCCGTACTGCTCCGGCA
TAGCAACGGGCCTTCTCGTTGCTATGTTTATTTTTGCCCTGCATCCTCGCACTAAAGAAA
GTCCGAGCTCGGGTCCGGGTGCTTTGGTCCGAGCAAAATGGCTTTGGCCCGGGAAGGATT
TATGTAGTTTTGGACGGCAGCTAAAGGCGAACAAGGTAAAAACTATACAATGGTTACGGA
AATAGCATAGCGCTGGTAGGTAAGAGCTGAGGTTGAGGTATGTGTTGTTAGACAAAAGGG
CTATTGATGGGTTAGATATGAAGTTTTGGCGAAGCGCTTTTTGATTGTGAAGGCTTCTCA
GCCGGAACGTTTGGACGGAACGTTTGGACGGAATGTACTTCCGTTATACTTTTGGCCGGA
ATTGATTTTGGAAAATACACATCGAGAGACAATTATTTGAGGAACTTCACTTGTAGATAA
GTGGCCGTGCTTTATGGGTACCCGTGTACTGTATCATGGGTATTACTTTATCACGAAGTG
GAAACTTAGCTCTGGTCTCAGTACAAGATCTGAATGCATGGGGTTCTGCCATCCAATAGA
CAGAGTCGCAGATTATCGGCTCTTGGCAATGGCTTTGTCGAATTCTACATCTTCTTATTT
CACGAACACGCGTCATTATCAGATCACTTGGTACTAATCTGTCACACTGCTACTTGTACT
ATGAGCAGATGGTGTAGATCTGACAAAAATCAATGTACCAGGAAGATATCTGGATTCAAA
GCCTGTAGGAGAGTAATTATATTCCAATTGGTCGCAATGTTAATGGCCTGATCAGTCGCG
AGTATCATGGCTTTGGCCATGCTGACGCATCAACTCATACTTTTATTGCCATCAGAGACA
TCTCTGATGTTGTTGGCACTAATTTACTTATTAGTAACGATCGTTCAAGACATTGACTTC
AGACTAAAAGAAGAACGAAAACATTTGTACTGCCATCATCCCCGAAAGAGCTTGGCTCAA
ACCCCTTCTTTCTATAAAAAACTATCGATCCTAGTTCCCTTACCATGACACATTGGTAGA
AAGTGATCTGGCGTTGCAGTGAAATAAGAGTTAGACGAAAGATCGCAGGAAGGTTCAGAA
GTATGGCTGAGAGCCCGAAATCTGTGACGGTACCTTTAAGATAATGATGACTTATACCAT
TGGTGTACACCATATACCGAGACCAGAACTAAGTTTCGACCTACAAATTTGTATAAACAC
CGATCATTTTGATCGAACAGAAGACCTTATTACTGGAGTTGAAGAAATAATCAATTTCAC
TATCTAAGAATTTGATAGACTTCTCTCTGCGGAAGCCCGAACAAGATTCCAATAGAAGAC
TCAGAGTTACTCCATTAGGTAACAGCCATATCCATTATAATAACCCAAAAAATTACCATT
GTATCACACTGATAAATTTCTGATGCCTCTAACTGCCTCCTAAACCCCCACATGGACCAT
TCAGATGGTCTCCGTTATTCTTACATAGCATATATGGTCACATTATACGAAACACTGACA
GCACTCAAGTTCATTCCGCGCAGCTTCAGACGCTCCAACCTATAACTACCACAGGAC

The gene Kwal_55.19674 complement(74510..74908) is annotated in this region but switched OFF
[contig 159] FULL

The gene Kwal_55.19667 (72322..72579) is annotated in this region but switched OFF
[contig 159] FULL