>Intergenic-Kwal_47.trna22K-Kwal_47.18631 kwal_s_47 (904026..904592) 567bp
TCTTTTTTGCCACCGCAATCCACGTGACACAAATATCACGTGACTCTCGGATAACCTCCT
CTTTTCTTTTTTTGTCTAGCCTTTTCCCAGCTCATCGCAGCTCTCTTGGCACTCTCATTT
ACCAAAAAAACGATGCGAACTAACTCATCTTTAAACCCTTCAACTACCATAGCTCACCCA
CCATCTACGCCTCTCATCAACGTCGTCAATTTACTCTAAAATTTGTATATACAGCTGACT
ATCTTCTCTTCTCTTCTCTTCTCTTCTCATCGTAAGTCACTATTGTCACTATTGACTCAA
TTTTTATAATCTTTCTTTCCCTTACATTTGTGCTTACCAACACACATTTGCCACCCACAA
CACCTTTCCCTACAAACAGTGTAGGTCCAAGAGCCATTATCTGAGTACACAGTCGCGCCT
GTCCAAATACAACAGCAGCGCAAGTTTGTTGATTCAAAACTGGGTCTTTTGTTTACTCGT
CCACGTATCGAAGACTTTAAACTCTTTACTCGCCACTTTACCCCCCAGTTTCGCATTTAG
AAACTCTACAAGTGCCTTCAGAGCGCC

The gene Kwal_47.18628 (903980..904168) is annotated in this region but switched OFF
[contig 192] FULL