>Intergenic-Kwal_33.13215-Kwal_33.13225 kwal_s_33 (124951..127675) 2725bp
CTCAGCGCGACTTTGAATTTATTATGCTTTTGAAGTCCAATTTTCCAATATTGCACATTA
TGTCTACTCCGCAACTCACTTTTTTCGCCTTATATAACTAACTATACGCCAAAAATGCAG
TATCTGCACTCTTGAATTTTGCCAAGGTCTCGGGTCCCTCCACAACTGCCCCTAAACAAC
TCCCGGAACAAGATACTCCATCACTGATAAACTCAAACTCACCTGTTCTTACCTTCCTTG
CAGTATATCTCGCGCCGGTTGCCTGTTACATCCATTTTGGCCAATGATCTTGGGCGAGCA
CAGTTGTGATAGTTTTTACAGAGAAGAGCCGTAACGGGACTGAAGCTAGGAACTTGGTTA
ATTTCCGGCGAAATACGAGCAGAGTAACGTTTAGAAGGCGCTGAATTGAGAAACTTGGCG
CAGAATACGGCTCTGCGGCCCTAAATGATTTTACTAGGTGATGCCGTGAAGCCGCGATGG
GCACAAAATGACGTTTTTTTATGAGTTGTTACTTTTTCTTGGTCATGTTAAGGCTTGGCT
GCGGCGTTAAGAGTGATTATGTAAGGGTGACCATGATGATGTAATACAAGATTGATCTTC
ACGTGAGTATGATCACGTGATGTCAGAGTTTAGATATGGTATGCGAACTTGGGGCCCCGG
AAGATTGAGTAACGGAGCGGAAAGGGTATTTTTTAGCCAAGGGCTGGAGCCGCCGGGGTT
GGAAGCGCATTGCGACTTGAATTGCTAAGGGCAGGAATTTGTAGTTTTCGGTGAGACGAT
AGAGGCCTGGACGATGCAACTCGTGGGCTTGTATCGCAGCCAACGGTTCAGGTTGATCCG
TGTACTGTTAAGTAGCGAATTCTCCAGGCCTAATGGGCCTAGGCTTAGAGATTCTGGAAA
TAGAGCAAGTGGCAGGTTGGTCTTCGTGTGTGGTGACAGAGGCGATGGCTTTATTACCGT
ATAAGACGATTCTTTGTTAGTATCATCACATTATGCCAAGGCCGCCAGGGGATGCCTCAT
GGAACTGGACAAAACTATATTTTGCCAAGGCAAATGCCGTCACGGTATTCGTGTCACACA
GATTGCTAGCACTTTCGTGCTTCCATCATCCAATCCACCAGGGTCACGCAAAGACATAGT
TACCCTGCCTTATCCAAGTGTTCGGATAAAAAAAACAGACTGCAATTGTATATCACGTGA
TCTCGTCACCTTATCCCCTCCTACGAATCCTCCCCCCTCCTTGCATAATCCCCACTCCCG
TTACCCGGCGCTTCATTCCTGGTGGCAAAACTAAACCTACACCATCTCGGTCGTGTTCAA
GCGCTAAACAAGCGCCCAAACCCTTCCCTATCGCGTTATACTACACTCTCTCATTACCTC
GCAAAGTATGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGGGCCAACAGGCGGCA
GTCAAGATCGTGTCGAAGTCGATCTTTAGCAATCAGACCAACTCTTCGACCATTGTGGGG
TCCAACGACCCGGACGTTCTGCCCTATGGCATTGAACGTGAAATTATTATTATGAAGCTT
CTACACCACGCCAATGTTCTGCGTCTCTACGACGTATGGGAGACCAACTCGAACCTGTAC
ATGGTGCTGGAGTACGTCGAGAAGGGCGAGCTCTTCAATCTACTGGTAGAGCGCGGCCCA
CTGCCCGAGAACGAGGCCGTGCGCTTTTTCCGGCAAATAATCATCGGTATCTCATACTGC
CACGCGCTGGGCATCGTGCACCGGGACCTGAAGCCCGAGAACCTACTTCTGGACCATAAG
TTCAACATCAAGATCGCAGATTTTGGAATGGCCGCTCTGGAGAGCAAGGACAAGTTGCTC
GAGACTTCCTGCGGCTCGCCTCATT

The gene Kwal_33.13222 (127342..127788) is annotated in this region but switched OFF
FRAGMENT OF ADJACENT GENE -
YDR507C (GIN4) - putative serine/threonine kinase [contig 120] PARTIAL

The gene Kwal_33.13220 (125969..126244) is annotated in this region but switched OFF
[contig 121] FULL