>Intergenic-Kwal_27.11537-Kwal_27.11532 kwal_s_27 complement(839012..839197) 186bp
AACTCATCAGCCTTTAGCGACTTTAAATTGGTAACTAGCCCAAACCTTGGTCACTTTGGA
TCTGCCAACAGTTCTGCTGCTTCAACATCTGATCTAAGCAAAAATTTCAAGACGTTAAAA
ATATTAGAGCTCATCGCGACATCCAATTCGAACAAAAATCACAACTAGTAAGGATAACTG
AGCCAA

The gene Kwal_27.11536 complement(839030..839617) is annotated in this region but switched OFF
[contig 27] FULL