>Intergenic-Kwal_27.11503-Kwal_27.11500 kwal_s_27 complement(827207..828114) 908bp
TACCAAATTTTTGATAGCGACGAGTTAGTATGCCGCTTCTTAATCTCGTATTCGTTTCTA
TTCAACAGCTCATCGCCATCTTAAATAAGTTGTGAATCTTTTCAATCTCATCACCTCACG
TACAAAATGCTATCTAGTAAGACTGATCCGTCGTCGCCTTTGTCAAAGGTTGACGATCAG
AAGTGTCTGTGTATCATGCGTTGATTGGTATATTACAGCAATTTGTCTAGGACTCGTGCG
CTAGGCCACGCGATAGAACCTTGGGTTTGTGATAGCTGATCTTAAATTCGCTATTGATTT
CTTTCCAATGAACGAAGAAGAAACCCAATGTGCATCAATCAAAAACAAGTTTACACGGAG
AAATTAATCACTACGATCATATAAACCACTACAGAGATATTAACACAGGATAACCTGACG
TTGTTTGAAAATTACGCGAAATTTTTAGCAAAATATACTCATCTATTCATATTTACAAAA
ATATTCAGGCTTCAACTTATGAAAAAGACCAAACTACTACTTATGCCAGTGGGAACATCC
ATCAAATGGTACCAACAAAACAAATTATAGTGTCAAATCATTCAATTCCAGCCTTAAGTA
TATATGTATTACATAATCAACCACCAAATCAAGATTATTATTAAGTAAGCAGCCAGTCAC
TCCAAACGTATACGGTTGAGTTCAAAACAGAAAACCATTTCCGTTTGACTAGTCATTGGA
TGCTAATGAAATCTAGGTTGTGGAAGAGAGTCCCGGTTCGTGCTACTCTGTTCAAAATCG
TACCAACTCCCTTCAAAGTGTGCGCTTGAATACACCTAGCTCAACCACGTTCCCTGTCAC
ACTACCTTTCGCACGACCTGTTTGTTGCGTTGTTTTGAATAGCCAAGATTAAGGCCATCG
CCACGAAA

The gene Kwal_27.11502 complement(828031..828294) is annotated in this region but switched OFF
[contig 27] FULL