>Intergenic-Kwal_27.10286-Kwal_27.10275 kwal_s_27 complement(274417..275676) 1260bp
GTTGGCTTTTCTTGGTGAGTGTATGGAACCGGAAGGAACTAGTTTCCTATTAAACTGCGT
GTGCTAGCTGTTCTCTGCGCAGCAATAGTGCGTTGAGAATGCGCCTGAGATGCGGGACAC
TTTTGTTGGTGGGGTGCGGCCTGGGACCTTCACTTTTCTCCTGCCAGCTGACACGCTATG
AAAGATCTTGGAATCTGCTTCTGATTTTTCGGTTTGAATGCTACTGCTTTTGAAACAATG
GCTCTCTTTTTTTTTTTTCAACTCCTTTCCTCGAGTTGCCGTCAACTCGTTTCTCTCAAC
ACTTGTCGTATTAGGCTCACGCTGCTTGATGGTCTGTAAGACTGGCTGGTATTTCTTGCA
AAGCGCTGCTTCTAAGTACTTTGACCGATCCTTCCTAGCCTTGACTTGATTTCTTTCTGC
TCTGCTCTCGTTTGTTGAGCTAGTCTCTAGATCTCTTCAGGTACTATTGATTTCCAATTA
ATTATTATTCCTGGCGCCAGTTGTGATACCCTCGGAATTAAAAGTGTACCCTCGGAAAAC
GAAAGTCTTATAAAGCGGCCCTATCTGTAGCGGTTTGAACCTATTTGAAGACCGTAGGAG
CTGGAAGTACTCGAATATGCACCGTTGTTCGCCTAGTTGAACACTAGTCCCTTCAAGCTT
GATGTTGATGTATAGATGTGGTGGCTCATCGATATTGAATAATAAACAGGCGATGAGCTT
TTACAACTAGTATGAAAAAAAAAAAAAGGAACTGCTGAGGGCGGAGTTGTAAAAAAAAAA
TATTCTGGAAAAGATATGGCAAACGAGGGGAAAGTGGAAGAGAAGCACTAACGGAAGGAG
CCACGGTGGTAGATGACTTCTATTAGATAGTTGTATGAGGCGGGGAGAACAAAGCATCTT
TGACGATAGATCTTTGTGTCACCACTAACGAATAACCGCTCACATCACCTAGTACGAAAT
ATACCGTCATTCGAAAACGAGCACCATGAACGAAAACTTACTATATCATAAAACACGAAT
GAATATCTTTGTACGAAATCAAATATACAGTCATCTAATACGAATATTTTATCTCAGAGG
AAAAAAAAACCCTGTTGATAATCGCTCTGCACGGTCCAATTTCGGTCACTTTTCTAAAAG
AGATCTCCCCCGCCACCTTAACTGTCAGGATCGTATCCCTTCCACCGTCTGCCACAGAAC
ACGTATCATAGGAATTCGTACGCATTCCAAGCACCTACACCAGACTGCCCTTCTTTTATA

The gene Kwal_27.10281 complement(274416..274691) is annotated in this region but switched OFF
[contig 37] FULL