>Intergenic-Kwal_27.10263-Kwal_27.10258 kwal_s_27 complement(267475..268743) 1269bp
CGGTGTTTTATAATTATAGTGATGAACACTGGAAACTTCGGGATTTGACTGTCCTGTGTT
CTATACTATATGCTCGCGTCTTTCGTAGATAGGTTCCAAAGACGTTCTTGCCTAGGGCAC
AACTACATGCATGCTCGTTTTCCAATTACATGGGGCACAACGTAGCGTCAGAAACTTCAC
AATACAGCGGGTTTTTACAAGTGCCCGTCTTCTCTTTCTATCGCGCGATGGTATGGATCC
TGTAGAGCTCCAATTGCATTTAACGGGATTGCAGCGGACAAGCTTAGCAATGCCCATTGA
AAGCTTCCGGTTTTATCTAGTAGGTCTCAAATTAGCATCTGTAGTTCACATGATCAAATC
TAGGATCTTAAATTCTAAACCTGTAAAGAGAACGTGATATTTCGTTAAACGCCCCAGACC
ATCAAGGTCGGGCTTAAATTCGCATTATGAATTATTCCGCGCTTGCACCACGCTTCCTGA
GATACCAACCTGTGATTTTTCCAGGAGCTATAGGGCCTTACAACTACTAGTAGACTTACT
CAATTAACTCATCGCTTTTCAAAGGGCAAAAATCAGTGACCCGGGAATTGAGAGTCCTTA
CTGCACGAAAAGCCAAGACCGAAAACGTAGAACGTACAAGTTTGAAAAGTAATCTCCGCG
CTCGCTGGACGCTTCCAAAGTTCAGCAGAATCTTTGGCAGCCATCAGCGTGTGCCAGTAA
AGATAAAGCATTAAAAAGAGGCGTCTAGCTTAGCTTTCCTGAGTAGATTCTACGAGTGAG
TGAGCGCCTTTTTTTTCGATTAATATCAATCTGAGTCGTCGTTACTTGAAACTGGAAACC
ATTGCTCAGTTAATCAATAGTGCCGTTAGTCAAAAATGCAATGATGGCGTCTAAGATTTT
GTTATACAAAGTTTTTAAGGCCTTTTCCATGTGATTCTGCTACCATTCGGAACCTAACAT
AAGACCGACCATAGAGTAAAACACCAACGTTTACTTCATTGTCGCACACTTCATGGTTCT
GCCAATGTACTTTGTTTACTACTGAACACCTTCCTTGTTCTTGCTCATACTGACCGAGCG
CTTCTTAAATGTTTTTGGCTCTTCTGAGCTGTCCGGCGACCTAAGTACCTTTTTCACAAG
ATTAGATACCGAAGGTTCCACCACAGTTCCAGGCCACAGTTTAAAGAAAGTGACACACTC
ATAAAGTAAACACACCTACTTATAAAACGTGCAACAACAAGGTTAGGAAAGTTATCCAAG
TAACATCAA

The gene Kwal_27.10259 (267266..267478) is annotated in this region but switched OFF
[contig 37] FULL