>Intergenic-Kwal_27.10245-Kwal_27.10239 kwal_s_27 complement(258185..259089) 905bp
TAGCTCTCAGATTAGCTTGACTATGACTTAGTTGGCACGTCTCAAGCTTACCATATCCTA
CCGATTATTTCAGCTTTACCTGGTTTTTTACAAGATTTCGTTTCCGGTCTTTAGCGTAGA
TAATAGTGGATTATGAATCATTTTCAGATCACTTTTGACTTCTTTGGCAGGCCCAGACCA
TTTAAATCAGAAAAATTAGTGAGAATCTATTCCTCATACCATCATAGCTCGAATAGTATA
GAAGTTCCAGGAAGCAGATAACTGCTAGTCTCAGGCCATTAATAATTGAGTATACTCGAT
GGTATACATTTTTCAGGGCAAAGATTGTTAGTCTGTGCCGAAAAACAATAGTTCGATGAA
TTCACAATTCTGGAGTAAAAAACTGGAACGATTACCAACTGCAAGCCAGATGAAGAATTA
AATTCCATGTTTGAATACTTTGCCTCAATTTTTGTATTTGATAGAAAAGGAAGGGACGTG
GTTCAAGCATATATTGAAATAGCGGGTGAAATACACTAGCATTGGAGGTGCTCACTTACA
CAGCAGTAGGCGGGAAGATATGGGGCTCTCAAGCCGTGCGCTTTGATTTGGACGCTACTG
TGAATTGCAATAGATCAATTTGTAGCTTGCAAGATTCACTGAATTTACAGTAAGTACTCA
TTTGCTGCAGTAAAGATATCGTTTGTAATGCATTGCATAATCCTCAGTTTCCGTTCCAAC
AGATCCATAGCGGCCGGCGTCACTGTGCTTTTTCAAACCATTATCTACCGAATCGGTCTT
GGCCCATTTTATGCCAAGGGCATAGCTGTGCCTGCTTGAAGTAAGACTATCTCACCAACT
TGTTTTATTGAAAAAAAAGATGCACTGCTCGCGACTCATTTGGTGCTAGCAGCTTCGTGT
AGTTC

The gene Kwal_27.10243 (257964..258245) is annotated in this region but switched OFF
[contig 38] FULL