>Intergenic-Kwal_27.10239-Kwal_27.10245 kwal_s_27 (258185..259089) 905bp
GAACTACACGAAGCTGCTAGCACCAAATGAGTCGCGAGCAGTGCATCTTTTTTTTCAATA
AAACAAGTTGGTGAGATAGTCTTACTTCAAGCAGGCACAGCTATGCCCTTGGCATAAAAT
GGGCCAAGACCGATTCGGTAGATAATGGTTTGAAAAAGCACAGTGACGCCGGCCGCTATG
GATCTGTTGGAACGGAAACTGAGGATTATGCAATGCATTACAAACGATATCTTTACTGCA
GCAAATGAGTACTTACTGTAAATTCAGTGAATCTTGCAAGCTACAAATTGATCTATTGCA
ATTCACAGTAGCGTCCAAATCAAAGCGCACGGCTTGAGAGCCCCATATCTTCCCGCCTAC
TGCTGTGTAAGTGAGCACCTCCAATGCTAGTGTATTTCACCCGCTATTTCAATATATGCT
TGAACCACGTCCCTTCCTTTTCTATCAAATACAAAAATTGAGGCAAAGTATTCAAACATG
GAATTTAATTCTTCATCTGGCTTGCAGTTGGTAATCGTTCCAGTTTTTTACTCCAGAATT
GTGAATTCATCGAACTATTGTTTTTCGGCACAGACTAACAATCTTTGCCCTGAAAAATGT
ATACCATCGAGTATACTCAATTATTAATGGCCTGAGACTAGCAGTTATCTGCTTCCTGGA
ACTTCTATACTATTCGAGCTATGATGGTATGAGGAATAGATTCTCACTAATTTTTCTGAT
TTAAATGGTCTGGGCCTGCCAAAGAAGTCAAAAGTGATCTGAAAATGATTCATAATCCAC
TATTATCTACGCTAAAGACCGGAAACGAAATCTTGTAAAAAACCAGGTAAAGCTGAAATA
ATCGGTAGGATATGGTAAGCTTGAGACGTGCCAACTAAGTCATAGTCAAGCTAATCTGAG
AGCTA

The gene Kwal_27.10243 (257964..258245) is annotated in this region but switched OFF
[contig 38] FULL