>Intergenic-Kwal_27.10232-Kwal_27.10227 kwal_s_27 complement(250481..251014) 534bp
AGTAGTGGCGATATTTTATTTTGGCGGTCTTGTCTCTGTTTTTCGGTTGACAAGTACTGT
TTTTCCTTAGGGATCGCCTTCAACAACTTTCAAAGATATCAATGGTATCTAGCCTGTACA
GACCTTTCAGTACTTGCAAATGGTTAGCACTGGATTATGAGGGCTTTGGAAGAAAGTGAT
GCGCTTATACCGTTCAACTTTTGTCGAAGACCGTTGCTGTGTGAAATCTCCACCAATTAA
CAGCTTTCTTGGCTTGAAACTTTTAAGAATCCCTGGCATACTCGTGTGAAAATACTTGAA
AAAACTAAGGACTTGGGTATAATAAATGCGGGGTTAACAAGTGCCCTGTGCCAGCCAGTA
TCAATGATAGTTGCGTTCCCAGACGAATTTGACTAGGATGAAGTCAATAGTCTACCTTTG
TAGTATATATCTGTATTTTGGTGAGATTTCTAGCTAGGTTCTCAGCGAAAAACTAGGGAC
TTAGCATTCCTGACAAACAGACCAAAGACGTGGGGCAAGAGAGAAAGGTCTGCG

The gene Kwal_27.10229 (250023..250553) is annotated in this region but switched OFF
[contig 39] FULL