>Intergenic-Kwal_27.10227-Kwal_27.10232 kwal_s_27 (250481..251014) 534bp
CGCAGACCTTTCTCTCTTGCCCCACGTCTTTGGTCTGTTTGTCAGGAATGCTAAGTCCCT
AGTTTTTCGCTGAGAACCTAGCTAGAAATCTCACCAAAATACAGATATATACTACAAAGG
TAGACTATTGACTTCATCCTAGTCAAATTCGTCTGGGAACGCAACTATCATTGATACTGG
CTGGCACAGGGCACTTGTTAACCCCGCATTTATTATACCCAAGTCCTTAGTTTTTTCAAG
TATTTTCACACGAGTATGCCAGGGATTCTTAAAAGTTTCAAGCCAAGAAAGCTGTTAATT
GGTGGAGATTTCACACAGCAACGGTCTTCGACAAAAGTTGAACGGTATAAGCGCATCACT
TTCTTCCAAAGCCCTCATAATCCAGTGCTAACCATTTGCAAGTACTGAAAGGTCTGTACA
GGCTAGATACCATTGATATCTTTGAAAGTTGTTGAAGGCGATCCCTAAGGAAAAACAGTA
CTTGTCAACCGAAAAACAGAGACAAGACCGCCAAAATAAAATATCGCCACTACT

The gene Kwal_27.10229 (250023..250553) is annotated in this region but switched OFF
[contig 39] FULL