>Intergenic-Kwal_26.8021-Kwal_26.8016 kwal_s_26 complement(613446..613991) 546bp
CAGGAAGAAACCACGAGAATGTGTTTTGGTAGTGAGACCCTGACCAACGAACCTTAACAC
GTACGCGGGTTGCAAAATAGAACGAAGGTTTGCACTTGGAATGTGCCGGTAGGAACCGTT
TGAAGGCGTAGGAACAACGCTCCGAAGGTTGTTCCCACATATATATATTATTTCAGACAC
ACCCTTGGTAGAAGAAGGAATCGAGGGAAGGGCCTGGAGCTAGAAAGAAGAGCGGCGGGC
ACCGTGACTGTGAGTATGTGAGATGTGAGTGTATGTGAGAAGGAGGCGTGTATGTTTGTG
TATAACCATCGGCGCCGGCCAGCGCGCGCGCAGCAATCCATACGTTGGATGTTGTTGTTA
GGCTTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTTGCTGA
AGCGAGTGGCACTCTTGTGTTTGTTTTGCGCAGGGTTGCAGCGACGCTGGGCGCCTGAGA
TGGCTGCAGTCAACAAAGCCTGGAATAAGGCTGGTTGCATGCAGTGGTATGCATAAACGG
CACGGT

The gene Kwal_26.8017 complement(613083..613463) is annotated in this region but switched OFF
[contig 55] FULL

The gene Kwal_26.8018 (613435..613824) is annotated in this region but switched OFF
[contig 55] FULL

The gene Kwal_26.8019 (613442..613819) is annotated in this region but switched OFF
[contig 55] FULL