>Intergenic-Kwal_26.7984-Kwal_26.7992 kwal_s_26 (600669..602281) 1613bp
AACCGCGGCAGGAGCAGCATTGATTATGCTTCTCTTTCTCGAAGTACATAAAACTATTGA
TTAAGTGCTTTATAAAGCGCACTTTTTCCAATTACGTTGGTAACGATATTAGAATGGTGT
TATGTTGATTAGCGAGCGTTATAGTTGATATTTACGAAGAACACGCTGAATCGACTTTAA
AAGACCCATCTCTATAAACCAGGGAGAAAACGCTGATAATTCGACTTTGAGGCGCTTTTG
GAAGGACCAAAATCCTGAAAATAATAAATTGCAGGTAATTCAACATGACTAAGTGACTCC
GAAATCAAATGAATGTTTCTAGTCTCGAAAAAGGAAATAGCCGCCGAGGTCAGCACACAC
CAGAAGCGACTACGGCGAAGTTTACAAGCAAAAAAGGCTGTTATAGTGATCATCAATGGA
GTGCCTCGAAAGTTTAGAGGAAAGTTACCTGCACCAAAGACTTTCAGATTTACTTTATAA
GTTGAAGTTCCGCTGAAAGTCCATCGTTCAAGATACTCTCAGCAAAACTTAAGGCGTTAT
TGAGACTATCCAGATTGTAGGACGTCAACGTGGGGTGTGTAATATGCAGAATGCAAGCCC
TCACCACAAAAAGTGTGGATATTCGAGCTTTTTTTTTTCGCTTCCTCCTATTCCTTTTGC
TCTCTGACAACCAGCTGGAGCTTTCACTTCGATGACTGTCGGAAACTCAATTCTCGGGTC
TACAAACAGAGTTCAGGGAGTGCCACGATAAGAGTACTCTTTGTGCCAACCATTTTGACC
AAGCTTTCAGTAAAGCGGTTAACACCCTCAAGAATTGACTTCGCATCTCCTATGCTCGCC
CCAAGTGCTCTTGCATTGCTAGTGCCGTCTTCCAGCTTGAAGGGAACGTGAGATCGATCG
CGAACATCTTATCTCTTTTTAACAGCCTAAAGAGCCCCATGCAAGCGCTTCTACTAATCC
TTAGCTACCATCAGCCATCCAAGCCATAACAATATATCCTATCGATATGCTCGCTTCACG
ATGATTTGTATTTACAATCGCTAGCTTAAAGTGTGCCTTAATCTGGTAGCGCCGAGTCTT
GTTGATTTTCGGAAAAACTCGGGAAAAGAAATTGATTTTGTGCATCTTTTTCCGTGAGTA
ATATTCAATTTATCCGAAAGACAAAGACCACGTACAACACGACAAACATCATCGTAGTAG
AGCTGCAAGAAGAGTTCAATGCCGATGACATGCTAATAGAATAACCTTCCCTCGCATAAG
CCAAGATTTTCCTAGTTATGGCCTTTGTTAGAGGACTGTTATCGCTTCTTCTCAAAAATC
AGTTTTACTGGCTCCATTGTTAATCTCATCCAAACTATGCCGGAACCGGACTTGGGCTCG
GGACAAACCGGCAGTGGAATTGAGAATTGAGCTGGAAAAAAAAAGCAAACGGCATAAGAA
TATTGATAACCGATGAGTATACAAATGGCGAGCGTGTTCTTGGAGAGTTTGCATTGGGTT
TGCAAAAGGTTGTTCAAGAATACAGCATTGGCTCTGCCGCTCAATACACTTTCTACTCAA
GAAACAAACCTTTGGATCAGTTAGTACTGCAAGAAACCTAAAGAAACCTAACA

The gene Kwal_26.7988 complement(600860..601081) is annotated in this region but switched OFF
[contig 55] FULL

The gene Kwal_26.7987 (600472..600732) is annotated in this region but switched OFF
[contig 55] FULL

The gene Kwal_26.7991 complement(601980..602162) is annotated in this region but switched OFF
[contig 55] FULL