CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.01 sec, SCORE=95, Nseq=6, Len=88 

Klac_4.trna1L   GGTTGTGTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGC----TCAGGT-
Ecym_3.trna1L   GGTTGTGTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGTGCACTCAGGT-
Sklu_5.trna1L   GGTTGTTTGGCCGAGCGGTCTAAGGCGTCCGATTCAAGC----TCGGAT-
Kthe_3.trna25L  GGTTGTTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGC----TCAGGT-
TBLA0Atrna23L   GGAGGGTTGGCCGAGTGGTCTAAGGCGGCAGACTTAAGA----TCTGTTG
NCAS0Dtrna9L    GGAGGGTTGGCCGAGTGGTCTAAGGCGGCAGACTTAAGA----TCTGTTG
                **  *  ******** *********** * ** * ***     ** * * 

Klac_4.trna1L   -ATCGTAAGATGCAAGAGTTCGAATCTCTTCGCAACCA
Ecym_3.trna1L   -ATCGTAAGATGCAAGAGTTCGAATCTCTTCGCAACCA
Sklu_5.trna1L   -ATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCA
Kthe_3.trna25L  -ATCGTAAGATGCAAGAGTTCGAATCTCTTAGCAACCA
TBLA0Atrna23L   GACAGT-GTCCGCGCGAGTTCGAACCTCGCATCCTTCA
NCAS0Dtrna9L    GACGGTTGTCCGCGCGAGTTCGAACCTCGCATCCTTCA
                 *  **     **  ********* ***    *   **


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Klac_4.trna1L
GGTTGTGTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGC----TCAGGT--ATCGTAAGA
TGCAAGAGTTCGAATCTCTTCGCAACCA
>Ecym_3.trna1L
GGTTGTGTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGTGCACTCAGGT--ATCGTAAGA
TGCAAGAGTTCGAATCTCTTCGCAACCA
>Sklu_5.trna1L
GGTTGTTTGGCCGAGCGGTCTAAGGCGTCCGATTCAAGC----TCGGAT--ATCGTAAGA
TGCAAGAGTTCGAATCTCTTAGCAACCA
>Kthe_3.trna25L
GGTTGTTTGGCCGAGCGGTCTAAGGCGCCTGATTCAAGC----TCAGGT--ATCGTAAGA
TGCAAGAGTTCGAATCTCTTAGCAACCA
>TBLA0Atrna23L
GGAGGGTTGGCCGAGTGGTCTAAGGCGGCAGACTTAAGA----TCTGTTGGACAGT-GTC
CGCGCGAGTTCGAACCTCGCATCCTTCA
>NCAS0Dtrna9L
GGAGGGTTGGCCGAGTGGTCTAAGGCGGCAGACTTAAGA----TCTGTTGGACGGTTGTC
CGCGCGAGTTCGAACCTCGCATCCTTCA