CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=95, Nseq=15, Len=88 

Zrou_3.trna40Y    CTCTCGGTGGCCAA-GTTGGTTTAAGGCGCCAGACT--------GTA--A
TDEL0Btrna6Y      CTCTCGGTGGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
Ecym_4.trna21Y    CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCCAGACT--------GTA--A
TBLA0Btrna8Y      CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
NDAI0Ktrna1Y      CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
NDAI0Etrna8Y      TTTAAAACACGAAATCTTGAGATCGGGCGTTCGACTCGCCCCCGGGAGAA
NCAS0Btrna5Y      CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
NCAS0Ctrna1Y      CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
KAFR0Ltrna6Y      TTTCCTTTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
KAFR0Atrna1Y      CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
Cgla_9.trna5Y     CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTA--A
Suva_13.trna473Y  CTCTCGGTAGCCAA-GTTGGTCTAAGGCGCAAGACT--------GTAATA
Skud_13.trna456Y  CTCTCGGTAGCCAA-GTTGGTCTAAGGCGCAAGACT--------GTAATA
Smik_13.trna499Y  CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATA
Scer_13.trna21Y   CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTA--A
                   *          **  ***   *  ****   ****        * *  *

Zrou_3.trna40Y    ATCTGGATATCGGGTGTTCGAATCACCC-CCGGGAG-A
TDEL0Btrna6Y      ATCTTGATATCGGGCGTTCGAATCGCCC-CCGGGAG-A
Ecym_4.trna21Y    ATCTGGAGATCGGGTGTTCGACTCACCC-CCGGGAG-A
TBLA0Btrna8Y      ATCTTGAGATCGGGCGTTCGACTCGCCCCCCGGGAG-A
NDAI0Ktrna1Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
NDAI0Etrna8Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
NCAS0Btrna5Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
NCAS0Ctrna1Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
KAFR0Ltrna6Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAGAT
KAFR0Atrna1Y      ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
Cgla_9.trna5Y     ATCTTGAGATCGGGCGTTCGAATCGCCC-CCGGGAG-A
Suva_13.trna473Y  ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
Skud_13.trna456Y  ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
Smik_13.trna499Y  ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
Scer_13.trna21Y   ATCTTGAGATCGGGCGTTCGACTCGCCC-CCGGGAG-A
                  **** ** ****** ****** ** *** *******  


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_3.trna40Y
CTCTCGGTGGCCAA-GTTGGTTTAAGGCGCCAGACT--------GTA--AATCTGGATAT
CGGGTGTTCGAATCACCC-CCGGGAG-A
>TDEL0Btrna6Y
CTCTCGGTGGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGATAT
CGGGCGTTCGAATCGCCC-CCGGGAG-A
>Ecym_4.trna21Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCCAGACT--------GTA--AATCTGGAGAT
CGGGTGTTCGACTCACCC-CCGGGAG-A
>TBLA0Btrna8Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCCCCCGGGAG-A
>NDAI0Ktrna1Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>NDAI0Etrna8Y
TTTAAAACACGAAATCTTGAGATCGGGCGTTCGACTCGCCCCCGGGAGAAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>NCAS0Btrna5Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>NCAS0Ctrna1Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>KAFR0Ltrna6Y
TTTCCTTTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAGAT
>KAFR0Atrna1Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>Cgla_9.trna5Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTA--AATCTTGAGAT
CGGGCGTTCGAATCGCCC-CCGGGAG-A
>Suva_13.trna473Y
CTCTCGGTAGCCAA-GTTGGTCTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>Skud_13.trna456Y
CTCTCGGTAGCCAA-GTTGGTCTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>Smik_13.trna499Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTAATAATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A
>Scer_13.trna21Y
CTCTCGGTAGCCAA-GTTGGTTTAAGGCGCAAGACT--------GTA--AATCTTGAGAT
CGGGCGTTCGACTCGCCC-CCGGGAG-A