CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=12, Len=73 

Zrou_3.trna20T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
TDEL0Gtrna10T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Klac_4.trna3T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Sklu_5.trna4T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Kthe_3.trna23T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Kwal_56.trna5T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Kpol_1037.trna2T  GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
TPHA0Jtrna5T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
NDAI0Ctrna2T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
NCAS0Dtrna3T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
KNAG0Mtrna6T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
KAFR0Gtrna15T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
                  **************************************************

Zrou_3.trna20T    CAGTTCGAATCTGGTTGGAAGCA
TDEL0Gtrna10T     CAGTTCGACTCTGGTTGGAAGCA
Klac_4.trna3T     CAGTTCGACTCTGGTTGGAAGCA
Sklu_5.trna4T     CAGTTCGACTCTGGTTGGAAGCA
Kthe_3.trna23T    CAGTTCAAATCTGGTTGGAAGCA
Kwal_56.trna5T    CGGTTCAAATCCGATTGGAAGCA
Kpol_1037.trna2T  CAGTTCGACTCTGGTTGGAAGCA
TPHA0Jtrna5T      CAGTTCGACTCTGGTTGGAAGCA
NDAI0Ctrna2T      CGGTTCAAATCCGATTGGAAGCT
NCAS0Dtrna3T      CAGTTCAAATCTGGTTGGAAGCA
KNAG0Mtrna6T      CAGTTCGACTCTGGTTGGAAGCA
KAFR0Gtrna15T     CAGTTCGACTCTGGTTGGAAGCA
                  * **** * ** * ******** 


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_3.trna20T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGAAT
CTGGTTGGAAGCA
>TDEL0Gtrna10T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Klac_4.trna3T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Sklu_5.trna4T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Kthe_3.trna23T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCAAAT
CTGGTTGGAAGCA
>Kwal_56.trna5T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>Kpol_1037.trna2T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>TPHA0Jtrna5T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>NDAI0Ctrna2T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCT
>NCAS0Dtrna3T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCAAAT
CTGGTTGGAAGCA
>KNAG0Mtrna6T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>KAFR0Gtrna15T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA