CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=22, Len=73 

Zrou_1.trna10T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
TDEL0Dtrna1T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Klac_5.trna16T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Agos_5.trna26T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Sklu_3.trna16T    GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Kpol_1036.trna3T  GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
TPHA0Atrna11T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
TBLA0Atrna16T     GCTTTCATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGT
NDAI0Atrna16T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
NDAI0Ltrna6T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
NCAS0Etrna12T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
KNAG0Jtrna3T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
KAFR0Atrna1T      GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Cgla_3.trna5T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Suva_2.trna140T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGT
Suva_4.trna240T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGT
Skud_2.trna125T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Skud_4.trna244T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Smik_2.trna132T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Smik_4.trna225T   GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Scer_2.trna6T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
Scer_4.trna4T     GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCAT
                  ****  ****************************************** *

Zrou_1.trna10T    CAGTTCGAATCTGGTTGGAAGCA
TDEL0Dtrna1T      CAGTTCGACTCTGGTTGGAAGCA
Klac_5.trna16T    CAGTTCGACTCTGGTTGGAAGCA
Agos_5.trna26T    CAGTTCGAATCTGGTTGGAAGCA
Sklu_3.trna16T    CAGTTCGACTCTGGTTGGAAGCA
Kpol_1036.trna3T  CAGTTCGACTCTGGTTGGAAGCA
TPHA0Atrna11T     CAGTTCGACTCTGGTTGGAAGCA
TBLA0Atrna16T     CAGTTCGACTCTGGTTGAAAGCA
NDAI0Atrna16T     CGGTTCAAATCCGATTGGAAGCA
NDAI0Ltrna6T      CGGTTCAAATCCGATTGGAAGCA
NCAS0Etrna12T     CAGTTCAAATCTGGTTGGAAGCA
KNAG0Jtrna3T      CAGTTCGACTCTGGTTGGAAGCA
KAFR0Atrna1T      CAGTTCGACTCTGGTTGGAAGCA
Cgla_3.trna5T     CAGTTCAAATCTGGTTGGAAGCA
Suva_2.trna140T   CGGTTCAAATCCGACTGGAAGCA
Suva_4.trna240T   CGGTTCAAATCCGACTGGAAGCA
Skud_2.trna125T   CGGTTCAAATCCGATTGGAAGCA
Skud_4.trna244T   CGGTTCAACTCCGATTGGAAGCA
Smik_2.trna132T   CGGTTCAAATCCGATTGGAAGCA
Smik_4.trna225T   CGGTTCAACTCCGATTGGAAGCA
Scer_2.trna6T     CGGTTCAAATCCGATTGGAAGCA
Scer_4.trna4T     CGGTTCAAATCCGATTGGAAGCA
                  * **** * ** *  ** *****


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_1.trna10T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGAAT
CTGGTTGGAAGCA
>TDEL0Dtrna1T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Klac_5.trna16T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Agos_5.trna26T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGAAT
CTGGTTGGAAGCA
>Sklu_3.trna16T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Kpol_1036.trna3T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>TPHA0Atrna11T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>TBLA0Atrna16T
GCTTTCATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGTCAGTTCGACT
CTGGTTGAAAGCA
>NDAI0Atrna16T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>NDAI0Ltrna6T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>NCAS0Etrna12T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCAAAT
CTGGTTGGAAGCA
>KNAG0Jtrna3T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>KAFR0Atrna1T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCGACT
CTGGTTGGAAGCA
>Cgla_3.trna5T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCAGTTCAAAT
CTGGTTGGAAGCA
>Suva_2.trna140T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGTCGGTTCAAAT
CCGACTGGAAGCA
>Suva_4.trna240T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCGTCGGTTCAAAT
CCGACTGGAAGCA
>Skud_2.trna125T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>Skud_4.trna244T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAACT
CCGATTGGAAGCA
>Smik_2.trna132T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>Smik_4.trna225T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAACT
CCGATTGGAAGCA
>Scer_2.trna6T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA
>Scer_4.trna4T
GCTTCTATGGCCAAGTTGGTAAGGCGCCACACTAGTAATGTGGAGATCATCGGTTCAAAT
CCGATTGGAAGCA