CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.07 sec, SCORE=100, Nseq=2, Len=72 

KNAG0Mtrna7D    TCCGCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGG
KAFR0Etrna4D    TCCGCGATAGTTTAATGGTGAGAATGGGCGCTTGTCGCGTGCCAGATCGG
                ******************* ******************************

KNAG0Mtrna7D    GGTTCAATTCCCCGTCGCGGAG
KAFR0Etrna4D    GGTTCAATTCCCCGTCGCGGAG
                **********************


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>KNAG0Mtrna7D
TCCGCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>KAFR0Etrna4D
TCCGCGATAGTTTAATGGTGAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG