CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=2, Len=72 

KNAG0Mtrna7R    GCTCGCATGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTCTG
KAFR0Etrna7R    GCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTCTG
                ****** *******************************************

KNAG0Mtrna7R    GGTTCGACCCCCAGTGTGAGTG
KAFR0Etrna7R    GGTTCGACCCCCAGCGTGAGTG
                ************** *******


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>KNAG0Mtrna7R
GCTCGCATGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTCTGGGTTCGACCC
CCAGTGTGAGTG
>KAFR0Etrna7R
GCTCGCGTGGCGTAATGGCAACGCGTCTGACTTCTAATCAGAAGATTCTGGGTTCGACCC
CCAGCGTGAGTG