CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.01 sec, SCORE=100, Nseq=19, Len=73 

Zrou_3.trna21R    TTCCTCGTGGCCCAATGGTCACGGCGTCCGGCTACGAACCGGAAGATTCC
TDEL0Gtrna10R     TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Klac_4.trna2R     TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Agos_3.trna9R     TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Ecym_3.trna2R     TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Sklu_5.trna2R     TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Kthe_3.trna24R    TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Kwal_56.trna4R    TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Kpol_1032.trna1R  TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Kpol_1037.trna1R  TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
TPHA0Jtrna8R      TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
TPHA0Mtrna1R      TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
TBLA0Gtrna2R      TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
KNAG0Mtrna6R      TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Cgla_12.trna11R   TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Suva_15.trna183R  TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Skud_15.trna169R  TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Smik_15.trna177R  TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
Scer_15.trna9R    TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCC
                  **************************** *********** *********

Zrou_3.trna21R    AGGTTCGAGTCCTGGCGGGGAAG
TDEL0Gtrna10R     AGGTTCGAGTCCTGGCGGGGAAG
Klac_4.trna2R     AGGTTCGAGTCCTGGCGGGGAAG
Agos_3.trna9R     AGGTTCGAGTCCTGGCGGGGAAG
Ecym_3.trna2R     AGGTTCGAGTCCTGGCGGGGAAG
Sklu_5.trna2R     AGGTTCGACTCCTGGCGGGGAAG
Kthe_3.trna24R    AGGTTCGACTCCTGGCGGGGAAG
Kwal_56.trna4R    AGGTTCGACTCCTGGCGGGGAAG
Kpol_1032.trna1R  AGGTTCGAGTCCTGGCGGGGAAG
Kpol_1037.trna1R  AGGTTCGAGTCCTGGCGGGGAAG
TPHA0Jtrna8R      AGGTTCGAGTCCTGGCGGGGAAG
TPHA0Mtrna1R      AGGTTCGAGTCCTGGCGGGGAAG
TBLA0Gtrna2R      AGGTTCGAGTCCTGGCGGGGAAG
KNAG0Mtrna6R      AGGTTCAAGTCCTGGCGGGGAAG
Cgla_12.trna11R   AGGTTCGAGTCCTGGCGGGGAAG
Suva_15.trna183R  AGGTTCAAGTCCTGGCGGGGAAG
Skud_15.trna169R  AGGTTCAAGTCCTGGCGGGGAAG
Smik_15.trna177R  AGGTTCAAGTCCTGGCGGGGAAG
Scer_15.trna9R    AGGTTCAAGTCCTGGCGGGGAAG
                  ****** * **************


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_3.trna21R
TTCCTCGTGGCCCAATGGTCACGGCGTCCGGCTACGAACCGGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>TDEL0Gtrna10R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Klac_4.trna2R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Agos_3.trna9R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Ecym_3.trna2R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Sklu_5.trna2R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGACT
CCTGGCGGGGAAG
>Kthe_3.trna24R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGACT
CCTGGCGGGGAAG
>Kwal_56.trna4R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGACT
CCTGGCGGGGAAG
>Kpol_1032.trna1R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Kpol_1037.trna1R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>TPHA0Jtrna8R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>TPHA0Mtrna1R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>TBLA0Gtrna2R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>KNAG0Mtrna6R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCAAGT
CCTGGCGGGGAAG
>Cgla_12.trna11R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCGAGT
CCTGGCGGGGAAG
>Suva_15.trna183R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCAAGT
CCTGGCGGGGAAG
>Skud_15.trna169R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCAAGT
CCTGGCGGGGAAG
>Smik_15.trna177R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCAAGT
CCTGGCGGGGAAG
>Scer_15.trna9R
TTCCTCGTGGCCCAATGGTCACGGCGTCTGGCTACGAACCAGAAGATTCCAGGTTCAAGT
CCTGGCGGGGAAG