CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=99, Nseq=5, Len=74 

TBLA0Btrna10P     GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCC
Suva_14.trna310P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCC
Skud_14.trna297P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGTATGCGAGAGGCCC
Smik_14.trna295P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCC
Scer_14.trna9P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--TGCGAGAGGCCC
                  ************************************  ************

TBLA0Btrna10P     TGGGTTCAATTCCCAGCTCGCCCC
Suva_14.trna310P  TGGGTTCAATTCCCAGCTCGCCCC
Skud_14.trna297P  TGGGTTCAATTCCCAGCTCGCCCC
Smik_14.trna295P  TGGGTTCAATTCCCAGCTCGCCCC
Scer_14.trna9P    TGGGTTCAATTCCCAGCTCGCCCC
                  ************************


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>TBLA0Btrna10P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCCTGGGTTCAAT
TCCCAGCTCGCCCC
>Suva_14.trna310P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCCTGGGTTCAAT
TCCCAGCTCGCCCC
>Skud_14.trna297P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGTATGCGAGAGGCCCTGGGTTCAAT
TCCCAGCTCGCCCC
>Smik_14.trna295P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCATGCGAGAGGCCCTGGGTTCAAT
TCCCAGCTCGCCCC
>Scer_14.trna9P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--TGCGAGAGGCCCTGGGTTCAAT
TCCCAGCTCGCCCC