CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=99, Nseq=15, Len=142 

Zrou_3.trna19P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
TDEL0Gtrna4P      GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-------------
Klac_6.trna5P     GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Ecym_3.trna9P     GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCGAAGCCTAGCCAA
Sklu_5.trna6P     GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Kthe_3.trna21P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Kwal_56.trna7P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Kpol_1037.trna3P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Kpol_1042.trna1P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
TPHA0Jtrna6P      GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGA-------------
Cgla_11.trna9P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
Suva_15.trna158P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-------------
Skud_15.trna147P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGT-------------
Smik_15.trna156P  GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-------------
Scer_15.trna8P    GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG--------------
                  ************************************              

Zrou_3.trna19P    --------------------------------------------------
TDEL0Gtrna4P      --------------------------------------------------
Klac_6.trna5P     --------------------------------------------------
Ecym_3.trna9P     AACTGGGTTAAACTACTAAGCGAAGCCTAGCCAAAACTGGGTTAAACTAC
Sklu_5.trna6P     --------------------------------------------------
Kthe_3.trna21P    --------------------------------------------------
Kwal_56.trna7P    --------------------------------------------------
Kpol_1037.trna3P  --------------------------------------------------
Kpol_1042.trna1P  --------------------------------------------------
TPHA0Jtrna6P      --------------------------------------------------
Cgla_11.trna9P    --------------------------------------------------
Suva_15.trna158P  --------------------------------------------------
Skud_15.trna147P  --------------------------------------------------
Smik_15.trna156P  --------------------------------------------------
Scer_15.trna8P    --------------------------------------------------
                                                                    

Zrou_3.trna19P    ------TGCGAGAGGCCCTGGGTTCAATTCCCAGTATGCCCC
TDEL0Gtrna4P      -----ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Klac_6.trna5P     ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Ecym_3.trna9P     TAAGCATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Sklu_5.trna6P     ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Kthe_3.trna21P    ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Kwal_56.trna7P    ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Kpol_1037.trna3P  ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Kpol_1042.trna1P  ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
TPHA0Jtrna6P      -----ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Cgla_11.trna9P    ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Suva_15.trna158P  -----ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Skud_15.trna147P  -----ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Smik_15.trna156P  -----ATGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
Scer_15.trna8P    ------TGCGAGAGGCCCTGGGTTCAATTCCCAGCTCGCCCC
                        ****************************   *****


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_3.trna19P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGTATGCCCC
>TDEL0Gtrna4P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-----------------------
---------------------------------------------ATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Klac_6.trna5P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Ecym_3.trna9P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGCGAAGCCTAGCCAAAACTGGGTTA
AACTACTAAGCGAAGCCTAGCCAAAACTGGGTTAAACTACTAAGCATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Sklu_5.trna6P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Kthe_3.trna21P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Kwal_56.trna7P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Kpol_1037.trna3P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Kpol_1042.trna1P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>TPHA0Jtrna6P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGA-----------------------
---------------------------------------------ATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Cgla_11.trna9P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Suva_15.trna158P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-----------------------
---------------------------------------------ATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Skud_15.trna147P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGT-----------------------
---------------------------------------------ATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Smik_15.trna156P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGGC-----------------------
---------------------------------------------ATGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC
>Scer_15.trna8P
GGGCGTGTGGTCTAGTGGTATGATTCTCGCTTTGGG------------------------
----------------------------------------------TGCGAGAGGCCCTG
GGTTCAATTCCCAGCTCGCCCC