CLUSTAL FORMAT for T-COFFEE Version_9.02.r1228 [http://www.tcoffee.org] [MODE:  ], CPU=0.00 sec, SCORE=100, Nseq=16, Len=72 

Zrou_3.trna11D    TCCGTGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGG
TDEL0Htrna5D      TCCGCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Klac_4.trna25D    TCCGCGATAGTTTAATGGTTAGAATTCGCGCTTGTCGCGTGCGAGATCGG
Agos_4.trna15D    TCCGCGATAGTTTAATGGTTAGAATTCGCGCTTGTCGCGCGCGGGATCGG
Sklu_6.trna13D    TCCGTGATAGTTTAGTGGCTAGAATTACCGCTTGTCGCGCGGTAGACCGG
Kthe_6.trna29D    TCCGCGATAGTTTAGTGGCTAGAATTCGAGCTTGTCGCGCTCGGGACCGG
Kwal_55.trna17D   TCCGCGATAGTTTAGTGGCTAGAATTCGAGCTTGTCGCGCTCGGGACCGG
Kpol_1062.trna4D  TCCGCGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
TPHA0Ctrna1D      TCCGGGATAGTTTAATGGTTAGAATCCGCGCTTGTCGCGTGCGGGATCGG
TBLA0Atrna14D     TCCCCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGG
NCAS0Etrna12D     TCCGTGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Cgla_11.trna1D    TCCGCGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Suva_9.trna196D   TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Skud_9.trna164D   TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Smik_9.trna186D   TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
Scer_9.trna9D     TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGG
                  ***  ********* ***  *****    **********     ** ***

Zrou_3.trna11D    GGTTCAATTCCCCGTCGCGGAG
TDEL0Htrna5D      GGTTCAATTCCCCGTCGCGGAG
Klac_4.trna25D    GGTTCAATTCCCCGTCGCGGAG
Agos_4.trna15D    GGTTCAATTCCCCGTCGCGGAG
Sklu_6.trna13D    GGTTCAATTCCCCGTCGCGGAG
Kthe_6.trna29D    GGTTCGATTCCCCGTCGCGGAG
Kwal_55.trna17D   GGTTCGATTCCCCGTCGCGGAG
Kpol_1062.trna4D  GGTTCAATTCCCCGTCGCGGAG
TPHA0Ctrna1D      GGTTCAATTCCCCGTTCCGGAG
TBLA0Atrna14D     GGTTCAATTCCCCGTCGAGGAG
NCAS0Etrna12D     GGTTCAATTCCCCGTCGCGGAG
Cgla_11.trna1D    GGTTCAATTCCCCGTCGCGGAG
Suva_9.trna196D   GGTTCAATTCCCCGTCGCGGAG
Skud_9.trna164D   GGTTCAATTCCCCGTCGCGGAG
Smik_9.trna186D   GGTTCAATTCCCCGTCGCGGAG
Scer_9.trna9D     GGTTCAATTCCCCGTCGCGGAG
                  ***** *********   ****


FASTA FORMAT for T-COFFEE /home/browser/Version_7.97

>Zrou_3.trna11D
TCCGTGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>TDEL0Htrna5D
TCCGCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Klac_4.trna25D
TCCGCGATAGTTTAATGGTTAGAATTCGCGCTTGTCGCGTGCGAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Agos_4.trna15D
TCCGCGATAGTTTAATGGTTAGAATTCGCGCTTGTCGCGCGCGGGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Sklu_6.trna13D
TCCGTGATAGTTTAGTGGCTAGAATTACCGCTTGTCGCGCGGTAGACCGGGGTTCAATTC
CCCGTCGCGGAG
>Kthe_6.trna29D
TCCGCGATAGTTTAGTGGCTAGAATTCGAGCTTGTCGCGCTCGGGACCGGGGTTCGATTC
CCCGTCGCGGAG
>Kwal_55.trna17D
TCCGCGATAGTTTAGTGGCTAGAATTCGAGCTTGTCGCGCTCGGGACCGGGGTTCGATTC
CCCGTCGCGGAG
>Kpol_1062.trna4D
TCCGCGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>TPHA0Ctrna1D
TCCGGGATAGTTTAATGGTTAGAATCCGCGCTTGTCGCGTGCGGGATCGGGGTTCAATTC
CCCGTTCCGGAG
>TBLA0Atrna14D
TCCCCGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGAGGAG
>NCAS0Etrna12D
TCCGTGATAGTTTAATGGTTAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Cgla_11.trna1D
TCCGCGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Suva_9.trna196D
TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Skud_9.trna164D
TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Smik_9.trna186D
TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG
>Scer_9.trna9D
TCCGTGATAGTTTAATGGTCAGAATGGGCGCTTGTCGCGTGCCAGATCGGGGTTCAATTC
CCCGTCGCGGAG